Article Text

Idiopathic dilated cardiomyopathy: lack of association with haemochromatosis gene in the CARDIGENE study
  1. G HETET1,
  2. B GRANDCHAMP1,
  3. C BOUCHIER2,3,
  4. V NICAUD3,4,
  5. L TIRET3,4,
  6. G ROIZÈS5,
  7. M DESNOS6,
  8. K SCHWARTZ7,
  9. R DORENT8,
  10. M KOMAJDA2,3,9,
  11. FOR THE CARDIGENE GROUP
  1. 1INSERM U409, Association Claude Bernard
  2. Université Paris VII, Paris
  3. 2Laboratoire Génétique et Insuffisance Cardiaque
  4. Association Claude Bernard/Université Paris VI
  5. Groupe hospitalier Pitié-Salpêtrière, Paris
  6. 3IFR 14 “Coeur, Muscles et Vaisseaux”, Paris
  7. 4INSERM U525, Paris
  8. 5INSERM U249, Montpellier
  9. 6Service de Cardiologie
  10. Hôpital Européen G Pompidou, Paris
  11. 7INSERM U523, Paris
  12. 8Service de Chirurgie Cardiaque
  13. 9Service de Cardiologie
  14. Groupe hospitalier Pitié-Salpêtrière, Paris
  15. France
  1. Dr C Bouchier, Laboratoire Génétique et Insuffisance Cardiaque, Pavillon Rambuteau, Groupe hospitalier Pitié-Salpêtrière, 47 bd de l'Hôpital, 75651 Paris cedex 13, France; bouchier{at}chups.jussieu.fr

Statistics from Altmetric.com

The hereditary haemochromatosis gene (HFE) has recently been proposed as a disease modifying gene.1 The rationale is that two common mutations of the HFE gene (C282Y and H63D) are found in a majority of patients with genetic haemochromatosis who are either homozygotes (C282Y/C282Y) or compound heterozygotes (C282Y/H63D). These mutations have been shown to contribute to more subtle modifications of iron homeostasis at the heterozygous state.2 In turn, iron may predispose to myocardial damage through the production of activated oxygen species. Recently, Mahon and colleagues have reported an association between the H63D mutation and idiopathic dilated cardiomyopathy (IDCM).3 In this study, 207 unrelated white patients with dilated cardiomyopathy and 200 controls were tested for HFE C282Y and H63D mutations. An increased proportion of H63D heterozygotes was found among patients (36%) as compared to the control group (27%). No association was found with C282Y mutation and as the H63D mutation had a relatively minor effect on iron status, these authors proposed that this association may be unrelated to iron metabolism. Surber and colleagues reported a study with 161 patients diagnosed with suspicion of myocarditis or IDCM where C282Y heterozygotes IDCM patients were significantly more frequent compared to controls.4

We have determined the frequency of both HFE mutations in the CARDIGENE study, a case–control study of IDCM enrolled in 10 different hospitals in France (for details on the population see Tesson and colleagues5). There were 426 patients with IDCM (339 men, 87 women). The mean (SD) age at diagnosis was 53 (10) years, and 229 patients had undergone cardiac transplantation. Patients with chronic excess alcohol consumption were not excluded. The study control group consisted of 401 subjects free of cardiovascular disease selected from the MONICA (monitoring trends and determinants in cardiovascular disease) project in France and matched for sex and age (329 men and 72 women, mean age 46 (8) years).

HFE C282Y and H63D mutations were tested by polymerase chain reaction (PCR) and allele-specific detection.

Amplification was performed in a 96 well microtitration plate as previously described6; 200 ng of genomic DNA were amplified in a total volume of 25 μl containing 20 pmol of 5' and 3' primers, 0.2 mM dNTPs, 6 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 5 pmol of each allele-specific molecular Beacon, and 0.75 U of AmpliTaq Gold DNA polymerase (ABI, France). The enzyme was heat activated at 96°C for 10 minutes followed by 40 cycles of denaturation at 95°C for 20 seconds, annealing at 55°C for 20 seconds and extension at 72°C for 20 seconds in UNO-Thermoblock (Biometra, Göttingen, Germany). After a final denaturation at 95°C for two minutes, hybridisation with the probes was carried out at 55°C for five minutes. The emission of fluorescence was recorded in a plate fluorometer fluostar (BMG, Germany) in two wavelength systems: 480–520 nm for fluorescein (FAM) and 520–590 for tetramethylrhodamine (TAMRA).

Primers and allele-specific probes were synthesised by Eurogentech (Seraing, Belgium):

C282Y:
forward primer: CTGTACCCCCTGGG- GAAGAGCAGAG
reverse primer: CCCAGATCACAATGAGGGGCTGATC
mutated probe: FAM- gcgac CCACCTGGTACGTATAT gtcgc –DABC YL
normal probe: TAMRA- gcgac CCACCTGGCACGTATAT gtcgc –DABCYL
H63D:
forward primer: GCTTTGGGCTACGTGGATGACCAGC
reverse primer: CCATGGAGTTCGGGG- CTCCACAC
mutated probe: FAM- gcgac TTCT ATGATGATGAGAGTC gtcgc –DABCYL
normal probe: TAMRA- gcgac TTCTATGATCATGAGAGTC gtcgc –DABCYL
DABCYL: 4-4'[dimethylaminophenylazo] benzoid acid.

 Data were analysed using the SAS statistical software (SAS Institute Inc, Cary, North Carolina, USA). Hardy-Weinberg equilibrium was tested by a χ2 test with 1 degree of freedom (df). Allele frequency was calculated by gene counting. The association of each polymorphism with the disease was tested by a χ2test comparing cases and controls with 2 df for H63D and 1 df for C282Y since, owing to low numbers, we pooled homozygotes and heterozygotes for the rare allele.

The association with variables characterising the severity of disease was tested similarly by comparing cases below and above the median of ejection fraction (median = 24) and left ventricular dilation (median = 40), and cases with and without cardiac transplantation.

Genotypes of both H63D and C282Y mutations could be determined in 418 cases and 372 controls. There was no significant deviation from Hardy-Weinberg equilibrium in controls as well as in cases. We did not find any association between the disease and any of the two HFE mutations (table 1). The odds ratio (95% confidence interval (CI)) for Y282 and D63 carrying were 0.94 (95% CI 0.58 to 1.52) and 0.90 (95% CI 0.66 to 1.23), respectively. Allele frequencies were similar in controls and patients (Y282: 0.051 and 0.055, D63: 0.17 and 0.18, respectively). Within the patient group, there was no relation between genotype and the severity of the disease, assessed by ejection fraction, left ventricular dilation, or cardiac transplantation.

Table 1

Distribution of genotypes for each polymorphism in cases and in control subjects

Our results on a large and well characterised population do not confirm the implication of these two common mutations in the HFE gene as genetically predisposing factors in IDCM. These contradictory results may result from different factors including sample size, different genetic background, selection criteria including degree of cardiac dilatation or ejection fraction reduction, or bias in the recruitment of the control population. These conflicting results point out the need for large populations in the search for genes susceptible to IDCM. Future studies should therefore be undertaken with clearly defined subgroups in order to determine the modulating influence of HFE mutations in dilated cardiomyopathy.

References

View Abstract

Request permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.