Article Text

PDF

Original article
Reduced Klotho is associated with the presence and severity of coronary artery disease
  1. Juan F Navarro-González1,2,
  2. Javier Donate-Correa1,
  3. Mercedes Muros de Fuentes3,
  4. Horacio Pérez-Hernández4,
  5. Rafael Martínez-Sanz5,
  6. Carmen Mora-Fernández1
  1. 1Research Division, Hospital Universitario Nuestra Señora de Candelaria, Santa Cruz de Tenerife, Spain
  2. 2Nephrology Service, Hospital Universitario Nuestra Señora de Candelaria, Santa Cruz de Tenerife, Spain
  3. 3Clinical Analysis Service, Hospital Universitario Nuestra Señora de Candelaria, Santa Cruz de Tenerife, Spain
  4. 4Cardiology Service, Hospital Universitario Nuestra Señora de Candelaria, Santa Cruz de Tenerife, Spain
  5. 5Cardiovascular Surgery Service, Hospital Universitario de Canarias, La Laguna, Spain
  1. Correspondence to Dr Juan F Navarro-González, Research División, University Hospital Nuestra Señora de Candelaria, Carretera del Rosario, 145, Santa Cruz de Tenerife 38010, Spain; jnavgon{at}gobiernodecanarias.org

Abstract

Objective Klotho is involved in vascular health. We aimed to analyse in a cross-sectional study the relationship between Klotho and human coronary artery disease (CAD).

Methods The study included 371 subjects who underwent coronary angiography and 70 patients who underwent elective cardiac surgery recruited between May 2008 and June 2009. The presence and severity (stenosis index) of CAD, cardiovascular risk factors, Klotho gene expression in the thoracic aorta, and serum soluble Klotho concentrations were evaluated.

Results The soluble Klotho concentration was lower (p<0.001) in patients with significant CAD (n=233). The maximal stenosis observed in every epicardial artery and the stenosis severity index was significantly lower in patients within the higher soluble Klotho concentrations (p<0.0001). Multiple regression analysis showed that serum Klotho concentrations were inverse and significantly associated with CAD (adjusted R2=0.67, p<0.001). Multivariate logistic regression analysis showed that risk factors for significant CAD included age, diabetes, smoking and inflammation, whereas high serum Klotho values were associated with a lower risk for CAD. Lower mRNA expression level of Klotho was observed in 46 patients with significant CAD, as compared with subjects without CAD (p=0.01). Logistic regression analysis showed that high Klotho gene expression was independently associated with lower risk for CAD.

Conclusions Patients with significant CAD present lower soluble concentrations of Klotho, as well as reduced levels of Klotho gene expression in the vascular wall. Reduced serum Klotho concentrations and decreased vascular Klotho gene expression were associated with the presence and severity of CAD independently of established cardiovascular risk factors.

  • Coronary Artery Disease
View Full Text

Statistics from Altmetric.com

Introduction

Coronary artery disease (CAD) remains the leading cause of death in the world.1 The risk of cardiovascular disease (CVD) can be quantified by associations among classical risk factors, but the susceptibility, severity, and progression of CAD is not completely explained by these factors. Thus, new biological systems could provide important additional information to improve our understanding of atherosclerotic disease biology and the assessment of cardiovascular risk.

Klotho, a gene originally identified in 1997 that encodes a novel protein, has been postulated as a regulator of the human aging process.2 Deletion of Klotho causes a phenotype similar to premature human aging, including endothelial dysfunction, progressive atherosclerosis, and shortened lifespan.3 There are two forms of the Klotho protein: (1) a transmembrane protein with a small intracellular carboxy-terminal domain and a large extracellular amino-terminal domain composed of two internal repeat sequences (KL1 and KL2), which is predominantly expressed in the kidney, although very recent studies have demonstrated its expression in human arteries4 ,5; and (2) two putative soluble proteins generated either from direct secretion by the cell due to an alternative splicing of the Klotho gene that leads to the production of a single KL1 domain, or from proteolytic cleavage of the extracellular domain of the membrane-bound form by secretases, that generates both full KL1-KL2 extracellular domain and/or the KL1 domain.6 ,7 These soluble forms are found in the cerebrospinal fluid, urine, and blood.

Normal aging is associated with a reduction in the renal expression and serum and urine concentrations of Klotho, which is also observed in diseases characterised by premature vascular aging, such as renal failure, hypertension (HT), and diabetes mellitus (DM).8 ,9 Klotho is involved in the protection of vascular health through different mechanisms, including inhibition of angiotensin II-induced reactive oxygen species production, protection against cell apoptosis and senescence, and modulation of inflammation.10–12 Therefore, Klotho has been suggested as a master regulator of CVD,13 with a potential role in the pathogenesis of atherosclerosis.14

Genetic studies have shown that variants of the Klotho gene are associated with atherosclerotic disease,15–17 and only one study has shown a significant association between higher plasma Klotho and lower risk of CVD.18 However, no studies have examined the relationship between serum and gene expression levels of Klotho and CAD. We conducted a cross-sectional study to test the hypothesis that reduced serum Klotho concentrations and decreased vascular Klotho gene expression are associated with the presence and severity of CAD.

Methods

Study population

Between May 2008 and June 2009, consecutive patients >18 years of age undergoing non-emergency coronary angiography as part of a diagnostic evaluation for CAD were considered for initial enrolment to study the relationship between soluble Klotho and CAD. Exclusion criteria were previous myocardial infarction, coronary angioplasty, intracoronary stent placement or coronary artery bypass graft surgery (CABG), haemodynamic instability, cardiac arrhythmia, immunologic or inflammatory diseases (such as rheumatoid arthritis, systemic lupus erythematosus, or inflammatory bowel disease), or renal failure (defined as an estimated glomerular filtration rate <60 mL/min/1.73 m2).19 To study the relationship between Klotho gene expression and CAD, thoracic aorta specimens were obtained from 144 consecutive patients who underwent elective CABG or valvular replacement surgery. No patient was receiving calcium, phosphate or vitamin D supplementation. All the protocols complied with the ethical standards of the Declaration of Helsinki and were reviewed and approved by the institutional ethics committee. Written informed consent was obtained from all participants.

Coronary angiography

Coronary angiography was performed using standard techniques. Angiograms were analysed blinded to the blood test results for serum Klotho and the gene expression analysis. Four major epicardial arteries were considered for assessment of coronary stenosis: left main coronary artery, left anterior descending artery, circumflex artery, and right coronary artery. A stenosis severity index (SSI) was defined as the average of the maximum stenosis in each of those arteries. Two groups were defined: (1) no significant CAD, comprising subjects with normal coronary arteries (0% stenosis) and patients with lesions of 1–49% stenosis in any epicardial coronary artery; and (2) significant CAD (SCAD), defined as the presence of at least one lesion leading to ≥50% lumen diameter stenosis of any of these arteries.20

Biochemical variables

Blood samples were drawn in the morning after an 8–10 h overnight fast before angiography. Samples were collected in Vacutainer SST tubes, and serum was immediately obtained and frozen in cryovials at −80°C. Serum high sensitive C reactive protein (hs-CRP) was measured by a high sensitivity particle enhanced immunoturbidimetric assay (Roche Diagnostics GmbH, Mannheim, Germany) in a Cobas 6000 analyser. The assay functional sensitivity was 0.3 mg/L and the intra- and inter-assay coefficient of variations (CVs) were 1.6 and 8.4, respectively. Circulating Klotho concentration was measured by a solid phase sandwich ELISA (Immuno-Biological Laboratories (IBL), Takasaki, Japan). The sensitivity was 6.15 pg/mL, and the intra-assay and inter-assay CVs were 3.1% and 6.9%, respectively. This assay uses two kinds of highly specific antibodies that recognise a tertiary protein structure of an extracellular domain of Klotho. As a consequence, with this assay both forms of circulating Klotho are measured (the shed product of the ectodomain of the membrane bound form, and the Klotho protein that originates from alternate splicing of the Klotho gene).21 Briefly, standards or samples are added to the precoated plate wells and incubated for 60 min at room temperature, followed by washing and then by the addition of labelled antibody solution with an additional incubation for 30 min. After a new wash, a TMB (3,3′,5,5′-Tetra Methyl Benzidine) solution is added to each well, and the reaction is terminated by the addition of a sulphuric acid solution. The colour change is measured spectrophotometrically at a wavelength of 450 nm within 30 min after addition of the stop solution.

A very recent study evaluated the quality of the three commercially available Klotho assays, and found that the IBL assay is the only one that provides information on the epitopes against which their antibodies are directed. In addition, this assay offered the best results after evaluation of different tests including within-run variation, between-run variation, matrix effects, linearity, and recovery.22 Finally, this assay has demonstrated its performance in other settings, such as in neonates, where soluble Klotho may have an impact on vitamin D metabolism and oxidative stress,23 in endocrine disorders such as acromegaly, because soluble Klotho appears to be a new biomarker reflecting disease activity,24 and in chronic kidney disease (CKD), because reduction in serum soluble Klotho has been independently associated with signs of vascular dysfunction in these patients.25

Vascular expression of Klotho: RNA extraction, RT-PCR and qRT-PCR

Thoracic aorta samples were immediately placed in RNAlater solution (Ambion Limited, UK) and stored at 4°C. Total RNA was isolated after complete homogenisation in TRI Reagent (Sigma-Aldrich, St Louis, Missouri, USA) and further purified using RNeasy Mini kit (Qiagen). An adequate quality of extracted RNA was tested using an Experion Automated Electrophoresis System (Bio-Rad Laboratories, Hercules, California, USA). RNA was quantified using a Thermo Scientific NanoDrop 2000 spectrophotometer (Thermo Scientific Nanodrop, USA). The cDNA was obtained using a high capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, California, USA) to be used as a template in retro-transcriptase PCR (RT-PCR) and in quantitative real-time PCR (qRT-PCR). Target sequences were amplified by RT-PCR using previously described intron-spanning primers and protocol parameters for KLOTHO mRNA.26 Primers (5′ to 3′) are: forward, actcccccagtcaggtggcggta; reverse, tgggcccgggaaaccattgctgtc. RT-PCR products were sequenced to confirm that the correct PCR products were amplified. Automated sequencing was carried out in an ABI 3500 genetic analyser with BigDye fluorescent terminator chemistry (Applied Biosystems). Transcripts encoding for KLOTHO and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were measured by TaqMan qRT-PCR with TaqMan Fast Universal PCR Master Mix (Applied Biosystems). TaqMan Gene Expression Assays for each transcript (Hs00183100_m1 (KLOTHO) and Hs99999905_m1 (GAPDH)) were analysed in a 7500 Fast Real-Time PCR System (Applied Biosystems). The level of target mRNA was estimated by relative quantification using the comparative method (2−ΔΔCt) by normalising to GAPDH expression. mRNA levels were expressed as arbitrary units. A corresponding non-reverse transcriptase reaction was included as a control for DNA contamination.

Statistical analysis

Continuous variables are reported as mean±SD or median (IQR) as appropriate. Categorical data are presented as frequencies or percentages. Normal distribution was assessed with the Kolmogorov-Smirnov test; thus, serum and Klotho expression levels were naturally log-transformed before incorporation into analysis. Categorical variables between groups were compared using χ2 test. Differences among groups were analysed by unpaired t test or one-way analysis of variance with Bonferroni post hoc test. Spearman correlation test was used to evaluate the relation between soluble Klotho concentrations and other variables. Forward stepwise multiple regression analysis was performed to determine the independent association between patient clinical parameters as potential predictor variables (age, sex, HT, DM, smoking, hyperlipidaemia, body mass index (BMI), serum uric acid, phosphorus and hs-CRP, and soluble Klotho concentrations) and severity of CAD expressed as the SSI as the dependent variable. Collinearity statistics (tolerance and variance inflation factor) were performed in order to detect correlations among the independent variables. A multiple logistic regression was performed to assess independent predictors of the presence of SCAD. For this purpose, we adopted three models: in model 1, we introduced conventional risk factors; in model 2, we additionally included uric acid, BMI, and hs-CRP; finally, in model 3, we adjusted the analysis for the soluble Klotho concentrations. Regarding gene expression analysis, quantification of each sample was tested in triplicate. Data were expressed as arbitrary units, and were logarithmically transformed for statistical analysis. Values of p<0.05 were considered significant. Statistical analysis was performed using IBM SPSS Statistics V.19 (IBM Corporation, Somers, New York, USA).

Results

Soluble Klotho concentrations and CAD

Four hundred and ninety-one patients were considered for enrolment in the study, and 120 were excluded due to exclusion criteria. Therefore, 371 patients were finally included. Table 1 shows the demographic and laboratory data. Two hundred and thirty-three patients (62.8%) presented with SCAD. The prevalence of HT (p<0.05), DM and smoking (p<0.001) were higher in this group, which was older in age (p<0.01) and had higher serum hs-CRP values (p<0.001).

Table 1

Clinical characteristics and biochemical assessments of patients included in the study

Soluble Klotho concentration was significantly lower in patients with SCAD (p<0.001) (figure 1). Likewise, serum Klotho concentrations were lower in patients with DM (318 (236–460) vs 364 (261–816) pg/mL, p<0.01) and in smokers (312 (228–423) vs 442 (263–852) pg/mL, p<0.001). There were no differences in subjects according to the presence of HT or dyslipidaemia. The characteristics of subjects stratified by tertiles of soluble Klotho are shown in table 2. Compared with the other patients, subjects with higher soluble Klotho concentrations (tertile 3) had a significantly lower prevalence of DM and smoking (p<0.001), as well as lower serum concentrations of total cholesterol (p=0.01) and hs-CRP (p<0.001).

Table 2

Clinical characteristics of participants stratified by tertile of soluble Klotho

Figure 1

Differences in the log-transformed levels of serum Klotho concentrations in patients with significant and non-significant coronary artery disease (CAD).

Regarding the severity of the coronary lesions, the maximal stenosis observed in every epicardial artery and the SSI were significantly lower in patients within tertile 3 of soluble Klotho concentrations (p<0.0001) (table 2). Subjects with normal coronary arteries (0% stenosis) had higher soluble Klotho concentrations than patients with stenosis <50% or with SCAD (933 (761–1071) vs 506 (364–586) and 275 (213–344) pg/mL, respectively, p<0.0001).

Soluble Klotho values correlated significantly and negatively with age (r=−0.10, p<0.05), serum phosphorus (r=−0.13, p=0.01), hs-CRP (r=−0.39, p<0.001), as well as the SSI (r=−0.69, p<0.0001). The SSI was also significantly correlated with age (r=0.17, p<0.01) and hs-PCR (r=0.65, p<0.0001). To test the independent association between soluble Klotho and severity of stenosis, forward stepwise multiple regression analysis was performed with the SSI as the dependent variable. The result showed that serum Klotho concentrations were inversely related and significantly associated with CAD (adjusted R2=0.67, p<0.001) (table 3). Collinearity was assessed by examining tolerance and the variance inflation factor (VIF) for each variable in the regression. Tolerance and VIF values were higher than 0.80 and lower than 1.25 for all variables, respectively. Therefore, collinearity was excluded.

Table 3

Multiple stepwise regression analysis for severity index of coronary stenosis as the dependent variable

The multivariate logistic regression modelling results, using the presence/absence of SCAD as the dependent variable, are presented in table 4. Traditional risk factors for CVD (age, sex, smoking, HT, DM, hyperlipidaemia) were entered as covariates, with additional models in which BMI, serum uric acid, hs-CRP (model 2), and soluble Klotho concentrations (model 3) were added as covariates. In model 1, age, smoking and DM were independent risk factors for SCAD. In model 2, in addition to the previous factors, hs-CRP was associated with SCAD. Finally, model 3 included soluble Klotho concentrations in addition to all the previous covariates, showing that soluble Klotho concentration is a protective factor for the presence of SCAD.

Table 4

Multivariate logistic regression analysis for the presence of significant coronary artery disease

Vascular expression of Klotho and CAD

From the 144 patients who underwent elective cardiac surgery, 74 were excluded due to different exclusion criteria. Therefore, 70 patients (32 males and 38 females), with a mean age of 65±7 years, were finally included in the study. When comparing patients according to the presence (N=46) or absence (N=24) of SCAD, there were no significant differences in age (64±8 vs 66±7 years), sex or prevalence of HT (65.2% vs 70.8%), DM (56.5% vs 37.5%) or dyslipidaemia (63% vs 66.6%) in regard to either therapy or general laboratory data. However, patients with SCAD had a higher prevalence of smoking (45.6% vs 12.5%, p<0.001). Interestingly, these subjects showed a significantly lower expression level of Klotho mRNA in the vascular wall (p<0.01) (figure 2). The multivariate logistic regression analysis using the presence/absence of SCAD as the dependent variable, and traditional cardiovascular risk factors and Klotho mRNA levels as covariates, showed that higher Klotho expression levels are associated with a lower risk for SCAD (table 5).

Table 5

Multivariate logistic regression analysis for the presence of significant coronary artery disease in the vascular Klotho expression study

Figure 2

Differences in the log-transformed mRNA levels of Klotho gene expression in the vascular wall of patients with and without significant coronary artery disease (CAD).

Discussion

Our data show that patients with SCAD had lower soluble concentrations of Klotho, as well as a reduced expression level of Klotho mRNA in the vascular wall. Moreover, the reduced serum Klotho concentrations and decreased vascular Klotho gene expression were associated with the presence and severity of CAD independently of established cardiovascular risk factors such as age, DM, HT, smoking, dyslipidaemia, and inflammation. Whether reduction of soluble Klotho concentrations and vascular klotho expression may directly promote or favour the development and progression of atherosclerosis is an intriguing possibility that requires further study.

Soluble Klotho is considered to act as a humoral factor, whereas the membrane form, which may also be secreted by proteolytic cleavage of the extracellular domain, may act as an autocrine or paracrine factor.2 ,4 ,14 Klotho mutated mice show multiple age-related disorders observed in humans, including endothelial dysfunction and atherosclerosis. Experimental studies show that klotho is associated with maintenance of endothelial integrity,27 and its actions comprise reduction of oxidative stress and increment of endothelial nitric oxide production, thereby improving endothelium-dependent vasodilatation.28 Furthermore, it decreases cell surface abundance of the calcium channel TRPC6, which is expressed in vascular smooth muscle cells (VSMC) and plays an important role in the regulation of vascular resistance and blood pressure.29 Importantly, soluble klotho administration has been shown to ameliorate the premature aging-related phenotype.30 In addition, it has been suggested that the Klotho protein might play a role in the pathogenesis of atherosclerotic disease.2 ,14 Studies analysing the relationship between Klotho and CAD in humans are very scarce, and most of them are genetic studies. These show that variants of the Klotho gene are associated with carotid atherosclerosis,31 stroke,32 and CAD.15 ,17 However, soluble Klotho and vascular Klotho expression levels were not analysed. Only one previous study18 has shown that soluble klotho is related to CVD (defined as CAD, heart failure, stroke, or peripheral arterial disease). Similar to our study, Semba et al18 found that soluble Klotho was independently associated with CVD, and that the risk of CVD was lower in subjects with higher Klotho concentrations. From the 1023 subjects in that study, only 51 had CAD. Our study included 371 subjects, with 233 suffering from SCAD. Other important factors in our study include the lower percentage of subjects older than 65 (56.8% vs >90%), since reduced Klotho has been related to older age, and that none of the subjects in our study had renal insufficiency (vs 24% of subjects having CKD in the work by Semba et al18), as CKD has been described as a state of Klotho deficiency.33 ,34

Experimental works have demonstrated that Klotho is involved in the pathogenesis of vascular calcification associated with CKD. Hu et al34 showed that klotho-deficient mice had undetectable concentrations of Klotho and severe vascular calcification, whereas transgenic mice that overexpressed Klotho had preserved Klotho concentrations with a dramatic attenuation of vascular calcification. More recently, Lim et al4 showed that vascular Klotho deficiency potentiated the development of accelerated vascular calcification. This beneficial action of Klotho has been related to the role of phosphorus in vascular calcification. Elevated phosphate is involved in a number of mechanisms that trigger and advance the progression of vascular calcification, including the transition of VSMC from a contractile to an osteochondrogenic phenotype, the mineralisation of VSMC matrix, the induction of VSMC apoptosis, and the inhibition of monocyte/macrophage differentiation into osteoclast-like cells.35 Phosphate transport into cells is primarily mediated by sodium dependent phosphate cotransporters, of which there are three types. The type I (Npt1 and Npt2) and type II (Npt2a, Npt2b and Npt2c) cotransporters in the kidney and intestinal epithelium play important roles in whole body phosphate homeostasis.36 The type III cotransporters, PiT-1 and PiT-2, are ubiquitously expressed, including expression in VSMC, and play a pivotal role in phosphate-induced VSMC calcification.37 ,38 Animals lacking klotho had increased expression of these cotransporters and the osteogenic transcription factor CBFA1/RUNX2 in VSMC, indicating that decreased klotho drives calcification. Furthermore, when klotho is added to VSMC in vitro, it decreases phosphate uptake by suppressing activity of the type III cotransporters and prevents the change of VSMC to an osteochondrogenic phenotype.34 In addition, Klotho is a phosphaturic substance acting directly on the Npt2a cotransporter to modulate renal phosphate excretion. Npt2a is the major regulated sodium phosphate cotransporter responsible for proximal tubule phosphate reabsorption, and Klotho modulates Npt2a in a biphasic fashion: it acutely decreases its intrinsic transport activity, and in a second phase induces changes in cell surface Npt2a.39

Our work is the first study of vascular Klotho expression and CAD in humans. A previous work by our group showed for the first time that the klotho gene is expressed in the human vascular wall.6 In the present study, we showed that patients with SCAD had a reduced vascular expression level of Klotho mRNA. In addition, the relationship between vascular klotho expression and CAD was independent of other CV risk factors.

From a mechanistic perspective, Klotho is involved in maintaining the health of the vasculature, and therefore disruption of Klotho homeostasis may be an important factor in the development of CVD.13 ,40 ,41 Klotho protects against endothelial dysfunction, a key factor in the pathogenesis of atherosclerosis. Klotho-deficient mice show increased vascular endothelial permeability, impaired endothelial-dependent vasodilation, reduced excretion of nitric oxide metabolites, and impaired angiogenesis and vasculogenesis.9 ,28 ,42 ,43 These dysfunctions completely recovered after parabiosis between wild-type and klotho-mutant mice,28 whereas in an animal model of atherosclerotic disease, klotho gene delivery resulted in amelioration of endothelial dysfunction, an increase of nitric oxide production, and prevention of adverse vascular remodelling.28 In addition, klotho protects endothelial and VSMC from inflammation and oxidation—critical factors in the pathogenesis of vascular disease.12 ,44 ,45 Finally, the bidirectional relationship between Klotho and inflammation is relevant. Both systemic and local inflammation have been related to a decreased renal klotho expression,46–48 whereas neutralisation of inflammatory cytokines has resulted in reversion of Klotho expression and preservation of circulating klotho levels.47 ,48 Therefore, it is possible to speculate that atherosclerosis—an inflammatory chronic disorder—is associated with impaired vascular klotho expression and reduced soluble klotho concentrations, which in turn may potentiate oxidative and inflammatory pathways resulting in development and progression of vascular damage.

Although the present study has some strengths (it was a population-based sample of adults, the presence and severity of coronary disease was carefully analysed, data included conventional cardiovascular risk factors, and CKD—a key confounding factor related to klotho deficiency—was excluded), we acknowledge several limitations. First, serum concentrations of vitamin D, fibroblast growth factor-23, and parathyroid hormone—factors related to Klotho and calcium phosphate metabolism, with potential impact on vascular calcification and CVD—were not measured in our study, and therefore their possible influence on the relationship between Klotho and CAD cannot be completely ruled out. Secondly, the study involved a relatively small sample size, so the findings may not be generalisable to the broader community. Thirdly, although we accounted for confounding of traditional cardiovascular risk factors, a potential for uncontrolled or residual confounding that could affect the Klotho–CAD relationship would be plausible. Finally, given the cross-sectional design of the study, we can only demonstrate associations without definitive inferences on their direction or causality. Nevertheless, this is the first study linking Klotho with CAD. Further experimental and clinical studies are warranted to confirm our findings, to explore the effects and relationships of Klotho on the cardiovascular system, and to evaluate the role of Klotho as a potential novel biomarker of CVD.

Key messages

What is already known about this subject?

  • Experimental studies have shown that Klotho may be a protective factor for vascular health, including protection against atherosclerosis. Regarding clinical studies, it has been shown that variants of the Klotho gene might be associated with atherosclerotic vascular disease. Finally, only one previous study has reported that decreased plasma klotho concentrations are related to cardiovascular disease in older patients.

What does this study add?

  • This study presents new evidence on the relationship between Klotho and atherosclerotic disease, specifically coronary artery disease. The results of the present study show that patients with significant coronary artery disease have lower soluble concentrations of Klotho, as well as a reduced expression level of Klotho mRNA in the vascular wall. Moreover, the reduced serum Klotho concentrations and the decreased vascular Klotho gene expression were associated with the presence and severity of coronary artery disease independently of established cardiovascular risk factors such as age, diabetes, hypertension, smoking, dyslipidaemia, and inflammation. All these findings suggest that reduction of soluble Klotho concentrations and vascular Klotho expression might promote or favour the development and progression of atherosclerotic vascular disease.

How might this impact on clinical practice?

  • Soluble Klotho concentrations may be useful as a clinical biomarker, resulting in an improvement of cardiovascular risk stratification, both in subjects with suspected cardiovascular disease as well as in patients with established disease. On the other hand, Klotho might be a therapeutic target. From this perspective, the increase in soluble Klotho concentrations and/or the vascular expression of Klotho might be associated with a protective action on the vascular wall, including anti-atherosclerotic effects.

References

View Abstract

Footnotes

  • Contributors JFN-G and CM-F conceptualised the study, and designed data collection tools and monitored data collection. JFN-G was the principal investigator. HP-H and RM-S were responsible for recruitment of patients and data collection. JD-C and MMdF were responsible for biochemical measurements and gene expression analysis. JD-C, JFN-G and CM-F analysed the data and wrote the draft of the paper, and all the authors contributed to its revision. All authors revised and approved the final version of the paper.

  • Funding This study was supported by Instituto de Salud Carlos IIII (ISCIII) [PI 07/0870 and PI10/0576]; Sociedad Española de Nefrología (SEN2011/2165); ACINEF [012010]. Research activity by JFNG is supported by Programa de Intensificación de la Actividad Investigadora, ISCIII/Canarias.

  • Competing interests None.

  • Patient consent Obtained.

  • Ethics approval The study was conducted with the approval of the Institutional Ethics Committee.

  • Provenance and peer review Not commissioned; externally peer reviewed.

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.